دانلود پایان نامه

سویا است. نتایج بدست آمده نشان داد که Multiplex PCR دارای حساسیت بسیار بیشتری نسبت به روش های دیگر است (Kim, Jeong et al. 2013).
یکی دیگر از روش های بسیار دقیق دیگر که برای شناسایی منشأ گونه های گوشتی 22 گونه حیوانی با تکثیر قطعه 359bp ژن سیتوکروم b میتوکندریایی و هضم محصول تکثیر شده توسط دو آنزیم استفاده شد، روش RFLP-PCR (اثرانگشت DNA) بود. تمام گونه ها به استثنای کانگورو و بوفالو با این دو آنزیم شناسایی شدند. محدودیت اصلی این آزمون عدم یکنواختی اندازه محصول تکثیر شده با مقدار DNA هدف موجود بود، بدین صورت که DNA خوک حتی در کمترین مقدار نسبت به سایر گونه ها تمایل دارد سایر گونه ها را بپوشاند. Partis و همکارانش در این تحقیق به این نتیجه رسیدند که این روش برای شناسایی بافت های پخته و خام کارایی دارد اما برای آنالیز مخلوط گوشتی مناسب نمی باشد (Partis, Croan et al. 2000).
Mane و همکارانش برای اعتبارسنجی فرآورده های گوشتی از روش PCR استفاده کردند. هدف از این مطالعه شناسایی گوشت گاو با استفاده از جفت آغازگر طراحی شده بر اساس منشأ D-loop ژن میتوکندریایی برای تکثیر قطعه 513bp گوشت تازه، گوشت فرآوری شده و اتوکلاو شده بود. نتایج این مطالعه نشان داد که این روش، روش آنالیز سریع و حساس گوشت و فرآورده های گوشتی حتی در گوشت مخلوط شده و فرآورده های گوشتی تا 1٪ تحت شرایط فرآوری مختلف است (Mane, Mendiratta et al. 2012).
Ciupa و همکارانش در مطالعه ای به بررسی گوشت گاوی در سوسیس، سالامی و سوسیس بولونا پرداختند. آنها در این مطالعه با استفاده از روش species-specific PCR و آغازگر ویژه گاو، قطعه ویژه 274bp از ژن سیتوکروم b میتوکندریایی را برای گوشت گاو تکثیرنمودند. وجود گوشت گاو در همه نمونه های سوسیس و سالامی تأیید شد اما در سوسیس های بولونا گوشت گاو وجود نداشت (Ciupa, Mihaiu et al. 2012).
با توجه به گرانی گوشت قرمز احتمال استفاده از گوشت مرغ و یا پروتئین گیاهی سویا بیشتر شده و این موضوع نگرانی افراد جامعه را در خصوص ناخالص بودن این محصول و عدم تطابق برچسب و محتویات داخل محصول را افزایش می دهد. بنابراین هدف از این مطالعه یافتن روشی ساده ، کاربردی و در عین حال ارزان قیمت برای مشخص نمودن میزان انطباق کیفیت مصولات با برچسب محصولات می باشد. با توجه به افزایش مصرف پروتئین سویا در فرآورده های گوشتی چرخ شده مانند همبرگرها و از سویی ذکر نام سویا به عنوان یکی از 12 ماده حساسیت زا اعلام شده از جانب قوانین کمیسیون غذایی (Codex alimentarius commission)، سازمان بهداشت جهانی (World Health Organization)، سازمان غذا و کشاورزی (Food and Agricultural Organization) و کمیسیون اروپا (European Commission) و نیز ضرورت درج نام سویا بر روی برچسب فرآورده های غذایی حاوی سویا، هم چنین الزام آشکارسازی نام تمام مواد اولیه بر روی برچسب فرآورده های غذایی مطابق قوانین کمیسیون اروپا، شناسایی پروتئین سویا در فرآورده های غذایی به منظور اطمینان از ایمنی غذا، برچسب زنی صحیح و حمایت از مصرف کننده ضروری است.
در این تحقیق بررسی مطالب ذکر شده بر روی برچسب محصولات و کیفیت خود محصولات بوسیله یک روش مولکولی ساده ، حساس و با دقت بالا مورد بررسی قرار می گیرد.

فصل دوم
• بخش تجربی؛ مواد و روش های تحقیق

2-مواد و روش کار
2-1-مواد، وسایل و تجهیزات لازم

مواد لازم برای استخراج ‏DNA :

• کیت استخراج DNA
• آب مقطر تزریقی (Ultrapure)
• Gel Red
• Loding dye

وسایل لازم برای استخراج DNA :

• میکروتیوپ cc‏ 5/1 و2/. cc
• سمپلر (1-10،10-100،100-1000)
• پنس، اسکالپل
• سر سمپلر (سفید، آبی ، زرد)

تجهیزات :

• ظرف حاوی یخ
• ورتکس
• Spin
• بن ماری ˚C65
• میکروسانتریفیوژ1200rpm/˚C4/10دقیقه
• دستگاه ترموسایکلر (ساخت شرکت Bio Rad، آمریکا)
• تانک الکتروفورز (ساخت شرکتBio Rad ، آمریکا)
• Power دستگاه الکتروفورز (ساخت شرکت Bio Rad، آمریکا)
• اسپکتروفتومتر یا نانودراپ (ساخت شرکت Thermo ،آمریکا)

2-2-جمع آوری نمونه ها
در این تحقیق به منظور شناسایی نوع گوشت به کار رفته در کباب لقمه ها و تائید برچسب فرآورده ها شهر تهران 10 نمونه صنعتی و 10 نمونه دست ساز تهیه گردید و به طور تصادفی شماره گذاری شدند به این صورت که نمونه های صنعتی از 10-1 و نمونه های دست ساز از 20-11 شماره گذاری گردیدند. جهت استخراج DNA در 20- نگهداری گردید. برچسب محصولات تاکید بر استفاده از گوشت خالص گاو به میزان 70% به بالا داشت.

2-3-استخراج DNA از نمونه ها
جهت استخراج DNA نمونه ها از کیت شرکت نوآوران دانش استفاده شد. تمام بافرها در دمای یخچال 4 تا 8 درجه سانتیگراد نگهداری شدند و پروتئیناز K نیز در دمای 20- نگهداری گردید. برای نمونه برداری از نمونه های کباب لقمه با رعایت بهداشت و به صورت استریل 10/0 گرم از نمونه توسط تیغ اسکالپر یکبار مصرف جدا شد و به داخل میکروتیوپ cc2 منتقل شد، سپس بعد از آزاد شدن DNA با 600 ماکرولیتر از بافر هضم کننده (Lysis Buffer) و 20 ماکرولیتر پروتئینازk به مدت 30 ثانیه ورتکس شد سپس داخل بن ماری در دمای 65 درجه سانتیگراد به مدت 3 ساعت قرار داده شد، هر 15 تا 20 دقیقه یکبار نمونه ها خارج شده و تکان داده شدند.
بوسیله سمپلر، 20 ماکرولیتر پروتئیناز k به نمونه ها اضافه شد، سپس به مدت 30 ثانیه ورتکس گردیدند،به مدت 5 ساعت در بن ماری 56 درجه سانتی گراد قرار گرفت تا محلول کاملا شفاف شود. سپس نمونه ها را در دمای 4 درجه سانتیگراد، با دور 12000 به مدت 10 دقیقه
جهت ایجاد دو فاز سانتریفیوژ گردیدند، محلول رویی را خارج ساخته محلول باقیمانده به میکروتیوپ cc2 جدید انتقال داده شد. بر روی میکروتیوپ ذکر شده به میزان 550 ماکرو لیتر از محلول Binding Buffer اضافه شد، سپس 15 ثانیه ورتکس شده و داخل سانتریفیوژ به مدت 10 دقیقه در دور 12000 قرار گرفت. بعد از خارج ساختن از سه فازی که شکل گرفته، محلول شفاف و مایع رویی را خارج ساده سپس به مدت 10 دقیقه با شرایط ذکر شده سانتریفیوژ انجام شد.
محلول رویی خارج گردید و 600 ماکرولیتر از محلولPrecipitation Buffer به آن اضافه گردید، مجددا در دور 12000 به مدت 10 دقیقه سانتریفیوژ شدند و محلول رویی به آرامی خارج شد. در این حالت DNAدر ته میکروتیوپ رسوب کرد. در این مرحله، به میزان 200 ماکرو لیتر از محلول Wash Buffer اضافه کرده و 19 دقیقه در دمای 4 درجه با دور 14000 سانتریفیوژ انجام شد. بعد از این مرحله نباید تکان زیادی به اپلیکون وارد نمود زیرا باعث تخریب DNA می گردد. محلول رویی را خارج نموده و رسوب به مدت 10 دقیقه داخل آون 50 درجه جهت خشک شدن قرارگرفت. سپس 50 ماکرو لیتر آب مقطر جهت حل نمودن رسوب به آن اضافه شد.نمونه ها جهت حلالیت بیشتر DNA بمدت 24 ساعت در یخچال نگهداری شدند.

مطلب مرتبط :   مقاله رایگان با موضوعمنابع حقوق، حقوق تجارت، حقوق جزا

2-4-بررسی کیفیت DNA استخراج شده
جهت بررسی DNA خالص شده از دو روش کمی و کیفی استفاده شد. در روش کیفی از الکتروفورز بر روی ژل آگارز 1% استفاده شد. بررسی کمیت و DNA استخراج شده بوسیله دستگاه نانو دراپ صورت گرفت، محاسبات این دستگاه بر اساس ضرایب شکست نور در محیط برای مواد گوناگون به خصوص اسیدهای نوکلئیک و پروتئین ها می باشد.

2-5-تهیه ژل آگارز 1٪ برای الکتروفورز
جهت تهیه cc50 ژل آگارز، 5/0 گرم پودر آگارز در ‎ cc‏50 ‏بافر ‏(‏TBE 1X‏)‏ با کمک حرارت ماکروویو (450 ولت، 60 ثانیه) حل شد و در Tray تراز شده که شانه در آن قرار گرفته، ریخته شد و پس از سرد شدن و بستن ژل، طوری که شانه به سمت الکترود منفی (سیاه رنگ) باشد، قرار داده شد و شانه به آرامی برداشته و بعد بافر الکتروفورز روی ژل ریخته شد تا چاهک را بپوشاند. برای بررسی کیفیت ‏DNA‏ استخراج شده، مقدار‏ ‏‎µl‎‏ 5‏ از هر نمونه ‎ DNA با µl1 از محلول بافرگذاری x loading dye 6 بر روی یک پارافیلم به وسیله سمپلر مخلوط شد و در ژل آگارز 1%، داخل هر چاهک بارگذاری شد و در چاهک آخر µl 1 مارکر (ladder 100 bp) تزریق شد. سپس رنگ آمیزی با gel red صورت گرفت و ژل در میدان الکتریکی با ولتاژ 120 ولت، راه اندازی شد. پس از رسیدن خط رنگ به یک پنجم نهایی ژل، جریان برق قطع و ژل از ‏دستگاه خارج شد و سپس ژل با استفاده از دستگاه ژل داک به کمک اشعه فرابنفش مورد بررسی قرار گرفت.‏

2-6- بررسی کمّیت وخلوص ‏DNA‏ استخراج شده
برای بررسی خلوص DNA استخراج شده از لحاظ کمّی از دستگاه نانودراپ جهت خواندن میزان نور جذب شده در طول موج های 260، 280 نانومتر و بدست آوردن نسبت 280/260 که بیانگر خلوص آن است، استفاده شد. ابتدا دستگاه را با آب مقطر تزریقی کالیبره کرده و بعد از خشک کردن قسمت مورد نظر با لنز پاک کن، به میزان µl1 از DNA با سمپلر تزریق شد تا دستگاه کمّیت نمونه را محاسبه کند.

2-7- مواد اولیه واکنش PCR
آغازگر ها:
آغازگرها توسط شرکت تکاپوزیست (کره جنوبی،Bioneer) سنتز شد. آغازگر های مورد استفاده در جدول 2-1 قابل مشاهده است.

نام آغازگر
ژن ها
توالی
وزن مولکولی(bp)
مرجع
chicken primer

12s rRNA
´ TGA GAA CTA CGA GCA CAA AC 3´5
‏ ‎‏´GGG CTA TTG AGC TCA CTG TT 3‎‏´‏5
183 bp

Dalmasso
et al. (2004)
cattle primer
cytochrome b
‎‏‏5 ́CTAGAAAAGTGTAAGACCCGTAATATAAG3´
‎‎‏‏GACCTCCCAGCTCCATCAAACATCTCATCT´5
TGATGAAA3 ́
274 bp
Matsunaga
et al. (1999)
Sheep primer
cytochrome b
(5′- CTATGAATGCTGTGGCTATTGTCGCA-3′)].
336bp
Matsunaga
et al. (1999)
Soya primer
lectin
5´GCCCTCTACTCCACCCCCATCC3´
5´GCCCATCTGCAAGCCTTTTTGTG3´
118 bp
Abd El-Nasser
et al. (2010)

مطلب مرتبط :   منابع و ماخذ تحقیقمکان کنترل، هیدرولیک

جدول 2-1-توالی آغازگر ها و اندازه قطعات تکثیر یافته با هر آغازگر در هر گونه

2-8-انجام واکنش های PCR
2-8-1-تهیه مخلوط اصلی
تهیه کردن مخلوط اصلی سبب می شود تا یکنواختی شرایط آزمایش برای نمونه های مختلف افزایش یابد و از طرفی دیگر آلودگی را به دلیل کاهش دفعات استفاده از سرسمپلر، میکروتیوب و … کاهش می دهد. بعد از مشخص شدن حجم هر واکنش، مخلوط اصلی تهیه شد. حجم و غلظت نهایی اجزای PCR برای واکنش µl25 در جدول 2-2 ذکر شده است. بر این اساس آماده کردن مخلوط اصلی به صورت زیر انجام شد.
پس از محاسبه حجم هر واکنش، تعداد نمونه های مورد بررسی با احتساب کنترل منفی مشخص شد. سپس حجم هر یک از اجزای واکنش در مخلوط اصلی برای تمام نمونه ها (معمولاً بیشتر از تعداد کل) محاسبه شد. قابل ذکر است که کلیه مراحل تهیه مخلوط اصلی روی یخ انجام شد. هم چنین تمامی مواد غیر از DNA و آنزیمTaq پلیمراز پس از ذوب شدن با چند تکان بسیار آرام مخلوط شده و تحت چرخش قرار گرفتند.

2-8-2-‎ Simplex PCR
با توجه به توضیحات این روش در بخش مقدمه، برای این نوع از PCR یک آغازگر(گاو یا گوسفند یا مرغ یا سویا) استفاده می شود که آن آغازگرها فقط باید با DNA استخراج شده از یک گونه (گاو یا گوسفند یا مرغ یا سویا) چه در نمونه های شاهد و چه در نمونه های کباب لقمه، واکنش دهد.

2-8-2-1-Simplex PCR نمونه های شاهد جهت تأیید اختصاصی بودن آغازگرها
با استفاده از آغازگرهای اختصاصی هر گونه شاهد (گاو، گوسفند، مرغ و سویا) و ‏DNA‏ استخراج شده از آن ها، اختصاصی بودن هر آغازگر مورد آزمایش قرار گرفت. یعنی در یک مرحله (با 3 بار تکرار آزمون) آغازگر هر گونه با ‏DNA‏ ‏مخصوص همان گونه تکثیر ش
د و در مرحله ای دیگر برای تائید عدم واکنش متقاطع (با 3 بار تکرار آزمون) آغازگر هر گونه با DNA مخصوص همان گونه(هدف) به همراه ‏DNA‏ های دیگر(یعنی غیر هدف) در یک ‏PCR‏ تکثیر گردید که (cross reaction)انتظار ما این بود که آغازگر هر گونه فقط ‏با ‏DNA‏ مخصوص همان گونه(هدف) واکنش دهد. ‏

مواد واکنش
حجم(‎µl‎‏25 ‏)
مخلوط اصلی امپلیکون‏
5/12 (ماکرولیتر)
آغازگر خاص هر گونه(reverse‎ )‏
5/0(میلی مولار)
آغازگر خاص هر گونه(forward‎)
5/0 (میلی مولار)
DNA‏ الگو‎ ‎
آب مقطر تزریقی
1(ماکرولیتر)
5/10 (ماکرولیتر)
جدول 2-2- مواد واکنش ‏ Simplex‎ PCR‏ (برای ‏‎µl‎‏ 25 از مخلوط واکنش) ‏

1) اجزای بالا، بجز DNA الگو، به یک میکروتیوپ cc 5/1 منتقل گردید. در حقیقت برای 5 نمونه (4 نمونه DNAشاهد (گاو، گوسفند، مرغ و سویا) و یک میکروتیوپ کنترل منفی) مخلوط اصلی تهیه شد. در طی اضافه کردن هر یک از مواد، میکروتیوپ حاوی مخلوط اصلی درون ظرف یخ قرار داده شد.
2) برای مخلوط کردن اجزا واکنش، میکروتیوپ به مدت 10 ثانیه اسپین شد.
3) از مخلوط اصلی تهیه شده به هر یک از میکروتیوپ های cc‎2/0 به میزانµl 24 به وسیله سمپلر منتقل شد. بجز میکروتیوپ کنترل منفی، DNA های الگوی شاهد به هر یک از میکروتیوپ ها اضافه شد.

2-8-2-2-بهینه سازی دمای Tm
قبل از انجام Simplex PCR، باید دمای بهینه فعالیت هر آغازگر مشخص شود. یک واکنش PCR با بکارگیری آغازگر اختصاصی هر کدام از گونه ها (گاو، گوسفند، مرغ و سویا) همراه با DNA استخراج شده هر یک از آن ها طی یک گرادیان دمایی اجرا می شود یعنی دمای مرحله اتصال آغازگر را متغیر قرار می دهیم تا ببینیم در کدام دما، برای محصول PCR، تک باند اختصاصی تشکیل می شود تا در مرحله Simplex PCR از آن استفاده شود.

مرحله
دما(سانتی گراد)
زمان(دقیقه)
تعداد چرخه
Denaturing

95

2

1

Denaturing
annealing

extention
94
60

72
1

1

’30/1

35
Final extention
72
5

جدول2-3-چرخه دمایی بهینه سازی دمای Simplex PCR ‏برای گاو، گوسفند و مرغ

به منظور بهینه سازی دمای Simplex PCR برای نمونه های گوشتی گاو، گوسفند و مرغ، دمای اتصال آغازگر در ˚C 58 و 59 و 60 انجام شد که با توجه به نتایج مناسب تر در دمای ˚C 60، این دما به عنوان دمای اتصال آغازگر انتخاب گردید.

مرحله
دما(سانتی گراد)
زمان(دقیقه)
تعداد چرخه
Denaturing
95
2
1
Denaturing
annealing

extention

94
1/62-5/59
) برای گرادیان دمایی)
72
1
1

’30/1

35
Final extention
72
5

جدول2-4- چرخه دمایی بهینه سازی دمایSimplex PCR ‏ ‏برای سویا

با توجه به نتایج مناسب و اشتراک هر دو گرادیان دمایی نمونه های گوشتی و سویا در دمای ˚C60، دمای اتصال آغازگر در تمام واکنش ها،˚C60 می باشد .
بنابراین


دیدگاهتان را بنویسید